Review



fluidigm sciences 201192b  (fluidigm)


Bioz Verified Symbol fluidigm is a verified supplier
Bioz Manufacturer Symbol fluidigm manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    fluidigm fluidigm sciences 201192b
    Fluidigm Sciences 201192b, supplied by fluidigm, used in various techniques. Bioz Stars score: 96/100, based on 216 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+id+intercalator+ir+fluidigm/Cell-ID+Intercalator-Ir/pmc13044534-113-13-13
    Average 96 stars, based on 216 article reviews
    fluidigm sciences 201192b - by Bioz Stars, 2026-10
    96/100 stars

    Images

    Related Articles

    Red Blood Cell Lysis:

    Article Title: Fecal microbiota transplantation improves anti-PD-1 inhibitor efficacy in unresectable or metastatic solid cancers refractory to anti-PD-1 inhibitor.
    Article Snippet: In brief Kim et al. show that fecal microbiota transplantation combined with anti-PD-1 therapy can overcome resistance in advanced solid cancers.. They identify Prevotella merdae Immunoactis, which enhances immune response and inhibits tumor growth, while confirming two nonefficacious strains that may inhibit T cell activity, suggesting that specific microbiota could improve immunotherapy effectiveness.

    Article Title: GCN2 is a determinant of the response to WEE1 kinase inhibition in small-cell lung cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Wee1 (D10D2) mAb Rabbit Cell Signaling Technology CAT# 13084T; RRID: AB_2713924 Anti-GCN2 (phospho T899) antibody Abcam CAT# ab75836; RRID: AB_1310260 GCN2 antibody Abcam CAT# ab157775; RRID: Phospho-S6 Ribosomal Protein (Ser235/236) (D57.2.2E) XP Rabbit Cell Signaling Technology CAT# 2211S; RRID: AB_331679 HSP90 Rabbit mAb Cell Signaling Technology CAT# 4877S; RRID: AB_2233307 ATF-4 (D4B8) Rabbit mAb Cell Signaling Technology CAT# 11815S; RRID: AB_2616025 Phospho-eIF2a (Ser51) (D9G8) XP Rabbit mAb Cell Signaling Technology CAT# 3398; RRID: AB_2096481 eIF2a (D7D3) XP Rabbit mAb Cell Signaling Technology CAT# 5324; RRID: AB_10692650 CDK1 Cell Signaling Technology CAT# 28439S; RRID: AB_2798959 phospho-CDK1 Cell Signaling Technology CAT# 9111S; RRID: AB_331460 Bacterial and virus strains EnduraTM Chemically Competent Cells Lucigen Cat# 60240-1 Chemicals, peptides, and recombinant proteins Polyethylenimine (PEI) Polysciences Cat# 23966-1 Polybrene Millipore-Sigma Cat# TR-1003-G Opti-MEM Thermo Fisher Scientific Cat# 31985088 RPMI 1640 Corning Cat# 15-040-CV DMEM Thermo Fisher Scientific Cat# 11965092 Bovine Growth Serum Thermo Fisher Scientific Cat# SH3054103HI Penicillin-Streptomycin-Glutamine Thermo Fisher Scientific Cat# 10378016 Fetal Bovine Serum Thermo Fisher Scientific Cat#16000044 Matrigel BD biosciences Cat# 356237 Tris(2-carboxyethyl) phosphine hydrochloride (TCEP) Thermo Fisher Scientific Cat# 77720 PBS antibody stabilizer Thermo Fisher Scientific Cat# NC0414486 Paraformaldehyde (PFA) Thermo Fisher Scientific Cat# 28906 Saponin Millipore-Sigma Cat# S7900-100G Bovine Serum Albumin (BSA) Millipore-Sigma Cat# A3059 Sodium azide Millipore-Sigma Cat# 71289 Cell-ID Intercalator-Ir Fluidigm Cat# 201192B L15 media Millipore-Sigma Cat# L1518 Collagenase I Millipore-Sigma Cat# C0130 Collagenase II Millipore-Sigma Cat# 6885 Collagenase IV Millipore-Sigma Cat# 5138 Elastase CellSystems Cat# LS002292 DNAseI Millipore-Sigma Cat# 10104159 RBC Lysis Buffer Thermo Fisher Scientific Cat# 00-4333-57 AZD-1775 SYNthesis Cat# WZQ-0447-032 Raphin1 Tocris Cat# 1A/242832 Histogel Thermo Fisher Scientific Cat# NC9150318 Triton X-100 Millipore-Sigma Cat# T8787-100ML (Continued on next page) Cell Reports 43, 114606, August 27, 2024 11 .. REAGENT or RESOURCE SOURCE IDENTIFIER PD 407824 (Wee1 and Chk1 inhibitor) Tocris Cat# 2694 DMSO Sigma-Aldrich Cat# D8418-500mL RIPA buffer Cell Signaling Technology Cat# 9806 Benzonase Merck-Millipore Cat# 71206-3 Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23227 Protein Assay Dye Reagent Bio-Rad Cat# 5000006 Streptavidin beads Thermo Fisher Scientific Cat# 20357 MgCl2 Sigma Cat# M8266 ActivXTM Desthiobiotin-ATP Probe Thermo Fisher Scientific Cat# 88311 2x Laemmli sample buffer Bio-Rad Cat# 1610737 PEG Sigma Cat# p5413 QIAamp DNA Blood Maxi Kit Qiagen Cat# 51194 BstXI NEB Cat# R0113S BlpI NEB Cat# R0585S QIAquick Gel Extraction Kit Qiagen Cat# 28704 T4 ligation buffer NEB Cat# B0202S SOC media Sigma Cat# S1797 Critical commercial assays Herculase II Fusion DNA Polymerase kit Agilent Cat# 600675 Deposited data RNA-seq data GEO GSE246354 Raw data Mendeley Data https://doi.org/10.17632/f5jtt3s8hv.1 Experimental models: cell lines 293T ATCC HTB-3216TM NCI-H82 ATCC HTB-175TM NJH29 Sage Lab N/A NCI-H69 ATCC HTB-119TM NCI-H2081 ATCC CRL-5920TM Experimental models: organisms/strains NOD-scid IL2Rgammanull mice (NSG mice) The Jackson Laboratory #005557 Oligonucleotides Genome-Wide CRISPR-KO library Morgens et al.,62 N/A oMCB1562: 50-AGGCTTGGATTTCTATAAC TTCGTATAGCATACATTATAC-30 Morgens et al.,62 N/A oMCB1563: 50-ACATGCATGGCGGTAAT ACGGTTATC-30 Morgens et al.,62 N/A oMCB1439: 50-CAAGCAGAAGACGGCAT ACGAGATGCACAAAAGGAAACTCACCCT-30 Morgens et al.,62 N/A R: 50-AATGATACGGCGACCACCGAGATC TACACGATCGGAAGAGCACACGTCTGAA CTCCAGTCACNNNNNNCGACTCGGTGC CACTTTTTC-30 Morgens et al.,62 N/A Sequencing primer: 50-GCCACTTTTTCAAG TTGATAACGGACTAGCCTTATTTAAACTTG CTATGCTGTTTCCAGCTTAGCTCTTAAAC-30 Morgens et al.,62 N/A

    Staining:

    Article Title: Fecal microbiota transplantation improves anti-PD-1 inhibitor efficacy in unresectable or metastatic solid cancers refractory to anti-PD-1 inhibitor.
    Article Snippet: In brief Kim et al. show that fecal microbiota transplantation combined with anti-PD-1 therapy can overcome resistance in advanced solid cancers.. They identify Prevotella merdae Immunoactis, which enhances immune response and inhibits tumor growth, while confirming two nonefficacious strains that may inhibit T cell activity, suggesting that specific microbiota could improve immunotherapy effectiveness.

    Article Title: JAK inhibition decreases the autoimmune burden in Down syndrome
    Article Snippet: .. (species) or resource Designation Source or reference Identifiers Additional information Commercial assay or kit V- PLEX Human Biomarker 54- Plex MesoScale Discovery Cat # K15248D Commercial assay or kit Transcription Factor Phospho Buffer Set BD Pharmingen Cat # 563239 Commercial assay or kit Cell Staining Buffer Fluidigm Cat # 201068 Commercial assay or kit Cell- IDTM 20- Plex Pd Barcoding Kit Fluidigm Cat # PRD023 Commercial assay or kit Cell- ID Intercalator- Ir Fluidigm Cat # 201192 A Commercial assay or kit Maxpar Antibody Labeling Kit Fluidigm Cat # 201160B Software, algorithm R R Foundation for Statistical Computing v4.3.1; RRID:SCR_001905 Software, algorithm R Studio R Studio, Inc v2023.09.1+494; RRID:SCR_000432 Software, algorithm Bioconductor Bioconductor v3.17; RRID:SCR_006442 Software, algorithm Tidyverse collection of packages for R CRAN RRID:SCR_019186 Software, algorithm limma package for R Bioconductor v3.56.2; RRID:SCR_010943 Software, algorithm FASTQC Babraham Institute v0.11.5; RRID:SCR_014583 Software, algorithm FastQ Screen Babraham Institute v0.11.0; RRID:SCR_000141 Software, algorithm bbduk/BBTools Bushnell et al., 2017 v37.99; RRID:SCR_016968 Software, algorithm fastq- mcf/ea- utils N/A v1.05; RRID:SCR_005553 Software, algorithm HISAT2 Kim et al., 2019 v2.1.0; RRID:SCR_015530 Software, algorithm Human genome sequence primary assembly fasta Gencode GRCh38; RRID:SCR_014966 Software, algorithm Human genome basic annotation GTF file Gencode v33; RRID:SCR_014966 Software, algorithm Samtools N/A v1.5; RRID:SCR_002105 Software, algorithm HTSeq- count N/A v0.6.1; RRID:SCR_005514 Software, algorithm DESeq2 package for R Bioconductor v1.28.1; RRID:SCR_015687 Software, algorithm fgsea package for R Bioconductor v1.26.0; RRID:SCR_020938 Software, algorithm Hmisc package for R CRAN V5.1.1; RRID:SCR_022497 Software, algorithm ggplot2 package for R CRAN v3.4.4; RRID:SCR_014601 Software, algorithm rstatix package for R CRAN v0.7.2; RRID:SCR_021240 Software, algorithm ComplexHeatmap package for R CRAN v2.4.2; RRID:SCR_017270 Software, algorithm tidyheatmap package for R CRAN V1.8.1 Software, algorithm ggforce package for R CRAN v0.4.1 Software, algorithm CellEngine CellCarta, Montreal, Canada RRID:SCR_022484 Software, algorithm flowCore package for R Hahne et al., 2009; Bioconductor v2.0.1; RRID:SCR_002205 Software, algorithm CATALYST package for R Chevrier et al., 2018; Bioconductor v1.12.2; RRID:SCR_017127 Appendix 1 Continued Appendix 1 Continued on next page Rachubinski et al. eLife 2024;13:RP99323. ..

    Sample Prep:

    Article Title: Fecal microbiota transplantation improves anti-PD-1 inhibitor efficacy in unresectable or metastatic solid cancers refractory to anti-PD-1 inhibitor.
    Article Snippet: In brief Kim et al. show that fecal microbiota transplantation combined with anti-PD-1 therapy can overcome resistance in advanced solid cancers.. They identify Prevotella merdae Immunoactis, which enhances immune response and inhibits tumor growth, while confirming two nonefficacious strains that may inhibit T cell activity, suggesting that specific microbiota could improve immunotherapy effectiveness.

    Cell Isolation:

    Article Title: Fecal microbiota transplantation improves anti-PD-1 inhibitor efficacy in unresectable or metastatic solid cancers refractory to anti-PD-1 inhibitor.
    Article Snippet: In brief Kim et al. show that fecal microbiota transplantation combined with anti-PD-1 therapy can overcome resistance in advanced solid cancers.. They identify Prevotella merdae Immunoactis, which enhances immune response and inhibits tumor growth, while confirming two nonefficacious strains that may inhibit T cell activity, suggesting that specific microbiota could improve immunotherapy effectiveness.

    other:

    Article Title: Multi-omics analysis of mucosal and systemic immunity to SARS-CoV-2 after birth.
    Article Snippet: Article Multi-omics analysis of mucosal and systemic immunity to SARS-CoV-2 after birth

    Article Title: Mesothelial cells with mesenchymal features enhance peritoneal dissemination by forming a protumorigenic microenvironment.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Purified anti-human Ki-67 (Maxpar(R) Ready) BioLegend Cat# 350523; RRID:AB_2562838 Purified anti-human MCP-1 BioLegend Cat# 502602; RRID:AB_315241 Purified anti-mouse CD138 (Syndecan-1) BioLegend Cat# 142502; RRID:AB_10965646 Purified anti-mouse/human CD44 (Maxpar(R) Ready) BioLegend Cat# 103051; RRID:AB_2562799 Rabbit Anti-Human EpCAM Polyclonal Antibody, Unconjugated Abcam Cat# ab71916; RRID:AB_1603782 Rat Anti-Human Mesothelin Monoclonal antibody, Unconjugated, Clone 420411 R and D Systems Cat# MAB32652; RRID:AB_2147798 Recombinant Anti-CDKN2A/p16INK4a antibody [EPR1473] Abcam Cat# ab186932; RRID:AB_2895712 Tenascin-C (EGF Like Domain) (4F10TT) Anti-Human Mouse IgG MoAb IBL Cat# 10337; RRID:AB_494663 Vimentin Monoclonal Antibody (VI-RE/1) Thermo Fisher Scientific Cat# MA1-19319; RRID:AB_1088255 Biological samples Ascites fluid from patients This paper N/A Peritoneal dissemination tissue from patients This paper N/A Chemicals, peptides, and recombinant proteins Recombinant human TGF-b1 PeproTech Cat# 100-21C Recombinant human IL-1b Miltenyi Biotech Cat# 130-093-895 VersaLyse Lysing Solution Beckman Coulter Cat# A09777 Cell-ID Cisplatin Fluidigm Cat# 201198 Human TruStain FcXTM BioLegend Cat# 422301 Maxpar Fix I Buffer Fluidigm Cat# 201065 Maxpar Perm-S Buffer Fluidigm Cat# 201066 Cell-ID Intercalator-Ir Fluidigm Cat# 201192A EQ Calibration Beads Fluidigm Cat# 201078 PKH26 Sigma‒Aldrich Cat# MINI26-1KT Lipofectamine RNAiMAX Transfection Reagent Thermo Fisher Scientific Cat# 13778-150 Bovine serum albumin Wako Cat# 01015094 Histofine antigen retrieval solution (pH 9.0) Nichirei bioscience Cat# 415211 Hoechst 33342 Dojindo Cat# 346-07951 4% paraformaldehyde Wako Cat# 163-20145 fetal bovine serum Capricorn Scientific Cat# FBS-LE-12A Opti-MEM Thermo Fisher Scientific Cat# 31985-070 RPMI-1640 Wako Cat# 189-02145 Critical commercial assays RNeasy Mini Kit QIAGEN Cat# 74106 RNase-Free DNase Set QIAGEN Cat# 79254 Human TGF-beta 1 Quantikine ELISA Kit R and D Systems Cat# DB100B Human IL-1 beta/IL-1F2 Quantikine HS ELISA Kit R and D Systems Cat# HSLB00D Human Tenascin C ELISA Kit Abcam Cat# ab277081 LEGENDplex Human Proinflammatory Chemokine Panel (13-plex) BioLegend Cat# 740985 BDTM Cytometric Bead Array (CBA) Human VEGF Flex Set BD BioSciences Cat# 558336 Direct RNA Sequencing Kit Oxford Nanopore Technologies Cat# SQK-RNA002 (Continued on next page) 18 Cell Reports --, 113613, --, 2023 OPEN ACCESS

    Article Title: AXL-initiated paracrine activation of pSTAT3 enhances mesenchymal and vasculogenic supportive features of tumor-associated macrophages.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human: HUVEC cells ATCC Cat#PCS-100-013 Human: peripheral blood CD14+ monocyte cells Stemcell Technologies Cat#70035 Experimental models: Organisms/strains Mouse: Nu/J The Jackson Laboratory JAX:002019, RRID: IMSR_JAX:002019 Oligonucleotides Primers for ChIP-qPCR This paper See Table S5 Primers for quantitative RT-PCR This paper See Table S6 Recombinant DNA pLenti-puro3/To/V5-GW/EGFP-Firefly luciferase Lorenzatti Hiles et al.59 Addgene119816; RRID:Addgene_119816 TRC-designed pLKO.1-puro Sigma Aldrich Cat#TRCN0000329887 Software and algorithms CyTOF (Version 7.0) Fluidigm RRID:SCR_021055 R package: cytofkit2 Chen et al.59 https://github.com/JinmiaoChenLab/cytofkit2 R package: ggplot2 Wickham60 http://ggplot2.tidyverse.org R package: destiny Angerer61 https://github.com/theislab/destiny R package: survival Therneau et al.62 https://github.com/therneau/survival EaSeq software Lerdrup et al.63 http://easeq.net ImageJ Schneider et al.64 https://imagej.nih.gov/ij/ R package: DESeq2 Love et al.65 https://doi.org/10.1186/s13059-014-0550-8 R package: EnhancedVolcano Blighe et al.66 https://github.com/kevinblighe/EnhancedVolcano R package: fgsea Korotkevich et al.67 https://github.com/ctlab/fgsea Compass for SW (Version: 3.1.7) ProteinSimple ZEN blue software Zeiss Company N/A MeV N/A http://mev.tm4.org/ Living Image software Caliper Life Science Prism 9 GraphPad https://www.graphpad.com/scientific- software/prism/RRID:SCR_002798 FlowJoTM v10.9 BD Biosciences RRID:SCR_008520

    Article Title: IRE1α silences dsRNA to prevent taxane-induced pyroptosis in triple-negative breast cancer.
    Article Snippet: Article IRE1a silences dsRNA to prevent taxane-induced pyroptosis in triple-negative breast cancer


    Biomarker Discovery:

    Article Title: JAK inhibition decreases the autoimmune burden in Down syndrome
    Article Snippet: .. (species) or resource Designation Source or reference Identifiers Additional information Commercial assay or kit V- PLEX Human Biomarker 54- Plex MesoScale Discovery Cat # K15248D Commercial assay or kit Transcription Factor Phospho Buffer Set BD Pharmingen Cat # 563239 Commercial assay or kit Cell Staining Buffer Fluidigm Cat # 201068 Commercial assay or kit Cell- IDTM 20- Plex Pd Barcoding Kit Fluidigm Cat # PRD023 Commercial assay or kit Cell- ID Intercalator- Ir Fluidigm Cat # 201192 A Commercial assay or kit Maxpar Antibody Labeling Kit Fluidigm Cat # 201160B Software, algorithm R R Foundation for Statistical Computing v4.3.1; RRID:SCR_001905 Software, algorithm R Studio R Studio, Inc v2023.09.1+494; RRID:SCR_000432 Software, algorithm Bioconductor Bioconductor v3.17; RRID:SCR_006442 Software, algorithm Tidyverse collection of packages for R CRAN RRID:SCR_019186 Software, algorithm limma package for R Bioconductor v3.56.2; RRID:SCR_010943 Software, algorithm FASTQC Babraham Institute v0.11.5; RRID:SCR_014583 Software, algorithm FastQ Screen Babraham Institute v0.11.0; RRID:SCR_000141 Software, algorithm bbduk/BBTools Bushnell et al., 2017 v37.99; RRID:SCR_016968 Software, algorithm fastq- mcf/ea- utils N/A v1.05; RRID:SCR_005553 Software, algorithm HISAT2 Kim et al., 2019 v2.1.0; RRID:SCR_015530 Software, algorithm Human genome sequence primary assembly fasta Gencode GRCh38; RRID:SCR_014966 Software, algorithm Human genome basic annotation GTF file Gencode v33; RRID:SCR_014966 Software, algorithm Samtools N/A v1.5; RRID:SCR_002105 Software, algorithm HTSeq- count N/A v0.6.1; RRID:SCR_005514 Software, algorithm DESeq2 package for R Bioconductor v1.28.1; RRID:SCR_015687 Software, algorithm fgsea package for R Bioconductor v1.26.0; RRID:SCR_020938 Software, algorithm Hmisc package for R CRAN V5.1.1; RRID:SCR_022497 Software, algorithm ggplot2 package for R CRAN v3.4.4; RRID:SCR_014601 Software, algorithm rstatix package for R CRAN v0.7.2; RRID:SCR_021240 Software, algorithm ComplexHeatmap package for R CRAN v2.4.2; RRID:SCR_017270 Software, algorithm tidyheatmap package for R CRAN V1.8.1 Software, algorithm ggforce package for R CRAN v0.4.1 Software, algorithm CellEngine CellCarta, Montreal, Canada RRID:SCR_022484 Software, algorithm flowCore package for R Hahne et al., 2009; Bioconductor v2.0.1; RRID:SCR_002205 Software, algorithm CATALYST package for R Chevrier et al., 2018; Bioconductor v1.12.2; RRID:SCR_017127 Appendix 1 Continued Appendix 1 Continued on next page Rachubinski et al. eLife 2024;13:RP99323. ..

    Antibody Labeling:

    Article Title: JAK inhibition decreases the autoimmune burden in Down syndrome
    Article Snippet: .. (species) or resource Designation Source or reference Identifiers Additional information Commercial assay or kit V- PLEX Human Biomarker 54- Plex MesoScale Discovery Cat # K15248D Commercial assay or kit Transcription Factor Phospho Buffer Set BD Pharmingen Cat # 563239 Commercial assay or kit Cell Staining Buffer Fluidigm Cat # 201068 Commercial assay or kit Cell- IDTM 20- Plex Pd Barcoding Kit Fluidigm Cat # PRD023 Commercial assay or kit Cell- ID Intercalator- Ir Fluidigm Cat # 201192 A Commercial assay or kit Maxpar Antibody Labeling Kit Fluidigm Cat # 201160B Software, algorithm R R Foundation for Statistical Computing v4.3.1; RRID:SCR_001905 Software, algorithm R Studio R Studio, Inc v2023.09.1+494; RRID:SCR_000432 Software, algorithm Bioconductor Bioconductor v3.17; RRID:SCR_006442 Software, algorithm Tidyverse collection of packages for R CRAN RRID:SCR_019186 Software, algorithm limma package for R Bioconductor v3.56.2; RRID:SCR_010943 Software, algorithm FASTQC Babraham Institute v0.11.5; RRID:SCR_014583 Software, algorithm FastQ Screen Babraham Institute v0.11.0; RRID:SCR_000141 Software, algorithm bbduk/BBTools Bushnell et al., 2017 v37.99; RRID:SCR_016968 Software, algorithm fastq- mcf/ea- utils N/A v1.05; RRID:SCR_005553 Software, algorithm HISAT2 Kim et al., 2019 v2.1.0; RRID:SCR_015530 Software, algorithm Human genome sequence primary assembly fasta Gencode GRCh38; RRID:SCR_014966 Software, algorithm Human genome basic annotation GTF file Gencode v33; RRID:SCR_014966 Software, algorithm Samtools N/A v1.5; RRID:SCR_002105 Software, algorithm HTSeq- count N/A v0.6.1; RRID:SCR_005514 Software, algorithm DESeq2 package for R Bioconductor v1.28.1; RRID:SCR_015687 Software, algorithm fgsea package for R Bioconductor v1.26.0; RRID:SCR_020938 Software, algorithm Hmisc package for R CRAN V5.1.1; RRID:SCR_022497 Software, algorithm ggplot2 package for R CRAN v3.4.4; RRID:SCR_014601 Software, algorithm rstatix package for R CRAN v0.7.2; RRID:SCR_021240 Software, algorithm ComplexHeatmap package for R CRAN v2.4.2; RRID:SCR_017270 Software, algorithm tidyheatmap package for R CRAN V1.8.1 Software, algorithm ggforce package for R CRAN v0.4.1 Software, algorithm CellEngine CellCarta, Montreal, Canada RRID:SCR_022484 Software, algorithm flowCore package for R Hahne et al., 2009; Bioconductor v2.0.1; RRID:SCR_002205 Software, algorithm CATALYST package for R Chevrier et al., 2018; Bioconductor v1.12.2; RRID:SCR_017127 Appendix 1 Continued Appendix 1 Continued on next page Rachubinski et al. eLife 2024;13:RP99323. ..

    Software:

    Article Title: JAK inhibition decreases the autoimmune burden in Down syndrome
    Article Snippet: .. (species) or resource Designation Source or reference Identifiers Additional information Commercial assay or kit V- PLEX Human Biomarker 54- Plex MesoScale Discovery Cat # K15248D Commercial assay or kit Transcription Factor Phospho Buffer Set BD Pharmingen Cat # 563239 Commercial assay or kit Cell Staining Buffer Fluidigm Cat # 201068 Commercial assay or kit Cell- IDTM 20- Plex Pd Barcoding Kit Fluidigm Cat # PRD023 Commercial assay or kit Cell- ID Intercalator- Ir Fluidigm Cat # 201192 A Commercial assay or kit Maxpar Antibody Labeling Kit Fluidigm Cat # 201160B Software, algorithm R R Foundation for Statistical Computing v4.3.1; RRID:SCR_001905 Software, algorithm R Studio R Studio, Inc v2023.09.1+494; RRID:SCR_000432 Software, algorithm Bioconductor Bioconductor v3.17; RRID:SCR_006442 Software, algorithm Tidyverse collection of packages for R CRAN RRID:SCR_019186 Software, algorithm limma package for R Bioconductor v3.56.2; RRID:SCR_010943 Software, algorithm FASTQC Babraham Institute v0.11.5; RRID:SCR_014583 Software, algorithm FastQ Screen Babraham Institute v0.11.0; RRID:SCR_000141 Software, algorithm bbduk/BBTools Bushnell et al., 2017 v37.99; RRID:SCR_016968 Software, algorithm fastq- mcf/ea- utils N/A v1.05; RRID:SCR_005553 Software, algorithm HISAT2 Kim et al., 2019 v2.1.0; RRID:SCR_015530 Software, algorithm Human genome sequence primary assembly fasta Gencode GRCh38; RRID:SCR_014966 Software, algorithm Human genome basic annotation GTF file Gencode v33; RRID:SCR_014966 Software, algorithm Samtools N/A v1.5; RRID:SCR_002105 Software, algorithm HTSeq- count N/A v0.6.1; RRID:SCR_005514 Software, algorithm DESeq2 package for R Bioconductor v1.28.1; RRID:SCR_015687 Software, algorithm fgsea package for R Bioconductor v1.26.0; RRID:SCR_020938 Software, algorithm Hmisc package for R CRAN V5.1.1; RRID:SCR_022497 Software, algorithm ggplot2 package for R CRAN v3.4.4; RRID:SCR_014601 Software, algorithm rstatix package for R CRAN v0.7.2; RRID:SCR_021240 Software, algorithm ComplexHeatmap package for R CRAN v2.4.2; RRID:SCR_017270 Software, algorithm tidyheatmap package for R CRAN V1.8.1 Software, algorithm ggforce package for R CRAN v0.4.1 Software, algorithm CellEngine CellCarta, Montreal, Canada RRID:SCR_022484 Software, algorithm flowCore package for R Hahne et al., 2009; Bioconductor v2.0.1; RRID:SCR_002205 Software, algorithm CATALYST package for R Chevrier et al., 2018; Bioconductor v1.12.2; RRID:SCR_017127 Appendix 1 Continued Appendix 1 Continued on next page Rachubinski et al. eLife 2024;13:RP99323. ..

    Sequencing:

    Article Title: JAK inhibition decreases the autoimmune burden in Down syndrome
    Article Snippet: .. (species) or resource Designation Source or reference Identifiers Additional information Commercial assay or kit V- PLEX Human Biomarker 54- Plex MesoScale Discovery Cat # K15248D Commercial assay or kit Transcription Factor Phospho Buffer Set BD Pharmingen Cat # 563239 Commercial assay or kit Cell Staining Buffer Fluidigm Cat # 201068 Commercial assay or kit Cell- IDTM 20- Plex Pd Barcoding Kit Fluidigm Cat # PRD023 Commercial assay or kit Cell- ID Intercalator- Ir Fluidigm Cat # 201192 A Commercial assay or kit Maxpar Antibody Labeling Kit Fluidigm Cat # 201160B Software, algorithm R R Foundation for Statistical Computing v4.3.1; RRID:SCR_001905 Software, algorithm R Studio R Studio, Inc v2023.09.1+494; RRID:SCR_000432 Software, algorithm Bioconductor Bioconductor v3.17; RRID:SCR_006442 Software, algorithm Tidyverse collection of packages for R CRAN RRID:SCR_019186 Software, algorithm limma package for R Bioconductor v3.56.2; RRID:SCR_010943 Software, algorithm FASTQC Babraham Institute v0.11.5; RRID:SCR_014583 Software, algorithm FastQ Screen Babraham Institute v0.11.0; RRID:SCR_000141 Software, algorithm bbduk/BBTools Bushnell et al., 2017 v37.99; RRID:SCR_016968 Software, algorithm fastq- mcf/ea- utils N/A v1.05; RRID:SCR_005553 Software, algorithm HISAT2 Kim et al., 2019 v2.1.0; RRID:SCR_015530 Software, algorithm Human genome sequence primary assembly fasta Gencode GRCh38; RRID:SCR_014966 Software, algorithm Human genome basic annotation GTF file Gencode v33; RRID:SCR_014966 Software, algorithm Samtools N/A v1.5; RRID:SCR_002105 Software, algorithm HTSeq- count N/A v0.6.1; RRID:SCR_005514 Software, algorithm DESeq2 package for R Bioconductor v1.28.1; RRID:SCR_015687 Software, algorithm fgsea package for R Bioconductor v1.26.0; RRID:SCR_020938 Software, algorithm Hmisc package for R CRAN V5.1.1; RRID:SCR_022497 Software, algorithm ggplot2 package for R CRAN v3.4.4; RRID:SCR_014601 Software, algorithm rstatix package for R CRAN v0.7.2; RRID:SCR_021240 Software, algorithm ComplexHeatmap package for R CRAN v2.4.2; RRID:SCR_017270 Software, algorithm tidyheatmap package for R CRAN V1.8.1 Software, algorithm ggforce package for R CRAN v0.4.1 Software, algorithm CellEngine CellCarta, Montreal, Canada RRID:SCR_022484 Software, algorithm flowCore package for R Hahne et al., 2009; Bioconductor v2.0.1; RRID:SCR_002205 Software, algorithm CATALYST package for R Chevrier et al., 2018; Bioconductor v1.12.2; RRID:SCR_017127 Appendix 1 Continued Appendix 1 Continued on next page Rachubinski et al. eLife 2024;13:RP99323. ..

    Virus:

    Article Title: GCN2 is a determinant of the response to WEE1 kinase inhibition in small-cell lung cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Wee1 (D10D2) mAb Rabbit Cell Signaling Technology CAT# 13084T; RRID: AB_2713924 Anti-GCN2 (phospho T899) antibody Abcam CAT# ab75836; RRID: AB_1310260 GCN2 antibody Abcam CAT# ab157775; RRID: Phospho-S6 Ribosomal Protein (Ser235/236) (D57.2.2E) XP Rabbit Cell Signaling Technology CAT# 2211S; RRID: AB_331679 HSP90 Rabbit mAb Cell Signaling Technology CAT# 4877S; RRID: AB_2233307 ATF-4 (D4B8) Rabbit mAb Cell Signaling Technology CAT# 11815S; RRID: AB_2616025 Phospho-eIF2a (Ser51) (D9G8) XP Rabbit mAb Cell Signaling Technology CAT# 3398; RRID: AB_2096481 eIF2a (D7D3) XP Rabbit mAb Cell Signaling Technology CAT# 5324; RRID: AB_10692650 CDK1 Cell Signaling Technology CAT# 28439S; RRID: AB_2798959 phospho-CDK1 Cell Signaling Technology CAT# 9111S; RRID: AB_331460 Bacterial and virus strains EnduraTM Chemically Competent Cells Lucigen Cat# 60240-1 Chemicals, peptides, and recombinant proteins Polyethylenimine (PEI) Polysciences Cat# 23966-1 Polybrene Millipore-Sigma Cat# TR-1003-G Opti-MEM Thermo Fisher Scientific Cat# 31985088 RPMI 1640 Corning Cat# 15-040-CV DMEM Thermo Fisher Scientific Cat# 11965092 Bovine Growth Serum Thermo Fisher Scientific Cat# SH3054103HI Penicillin-Streptomycin-Glutamine Thermo Fisher Scientific Cat# 10378016 Fetal Bovine Serum Thermo Fisher Scientific Cat#16000044 Matrigel BD biosciences Cat# 356237 Tris(2-carboxyethyl) phosphine hydrochloride (TCEP) Thermo Fisher Scientific Cat# 77720 PBS antibody stabilizer Thermo Fisher Scientific Cat# NC0414486 Paraformaldehyde (PFA) Thermo Fisher Scientific Cat# 28906 Saponin Millipore-Sigma Cat# S7900-100G Bovine Serum Albumin (BSA) Millipore-Sigma Cat# A3059 Sodium azide Millipore-Sigma Cat# 71289 Cell-ID Intercalator-Ir Fluidigm Cat# 201192B L15 media Millipore-Sigma Cat# L1518 Collagenase I Millipore-Sigma Cat# C0130 Collagenase II Millipore-Sigma Cat# 6885 Collagenase IV Millipore-Sigma Cat# 5138 Elastase CellSystems Cat# LS002292 DNAseI Millipore-Sigma Cat# 10104159 RBC Lysis Buffer Thermo Fisher Scientific Cat# 00-4333-57 AZD-1775 SYNthesis Cat# WZQ-0447-032 Raphin1 Tocris Cat# 1A/242832 Histogel Thermo Fisher Scientific Cat# NC9150318 Triton X-100 Millipore-Sigma Cat# T8787-100ML (Continued on next page) Cell Reports 43, 114606, August 27, 2024 11 .. REAGENT or RESOURCE SOURCE IDENTIFIER PD 407824 (Wee1 and Chk1 inhibitor) Tocris Cat# 2694 DMSO Sigma-Aldrich Cat# D8418-500mL RIPA buffer Cell Signaling Technology Cat# 9806 Benzonase Merck-Millipore Cat# 71206-3 Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23227 Protein Assay Dye Reagent Bio-Rad Cat# 5000006 Streptavidin beads Thermo Fisher Scientific Cat# 20357 MgCl2 Sigma Cat# M8266 ActivXTM Desthiobiotin-ATP Probe Thermo Fisher Scientific Cat# 88311 2x Laemmli sample buffer Bio-Rad Cat# 1610737 PEG Sigma Cat# p5413 QIAamp DNA Blood Maxi Kit Qiagen Cat# 51194 BstXI NEB Cat# R0113S BlpI NEB Cat# R0585S QIAquick Gel Extraction Kit Qiagen Cat# 28704 T4 ligation buffer NEB Cat# B0202S SOC media Sigma Cat# S1797 Critical commercial assays Herculase II Fusion DNA Polymerase kit Agilent Cat# 600675 Deposited data RNA-seq data GEO GSE246354 Raw data Mendeley Data https://doi.org/10.17632/f5jtt3s8hv.1 Experimental models: cell lines 293T ATCC HTB-3216TM NCI-H82 ATCC HTB-175TM NJH29 Sage Lab N/A NCI-H69 ATCC HTB-119TM NCI-H2081 ATCC CRL-5920TM Experimental models: organisms/strains NOD-scid IL2Rgammanull mice (NSG mice) The Jackson Laboratory #005557 Oligonucleotides Genome-Wide CRISPR-KO library Morgens et al.,62 N/A oMCB1562: 50-AGGCTTGGATTTCTATAAC TTCGTATAGCATACATTATAC-30 Morgens et al.,62 N/A oMCB1563: 50-ACATGCATGGCGGTAAT ACGGTTATC-30 Morgens et al.,62 N/A oMCB1439: 50-CAAGCAGAAGACGGCAT ACGAGATGCACAAAAGGAAACTCACCCT-30 Morgens et al.,62 N/A R: 50-AATGATACGGCGACCACCGAGATC TACACGATCGGAAGAGCACACGTCTGAA CTCCAGTCACNNNNNNCGACTCGGTGC CACTTTTTC-30 Morgens et al.,62 N/A Sequencing primer: 50-GCCACTTTTTCAAG TTGATAACGGACTAGCCTTATTTAAACTTG CTATGCTGTTTCCAGCTTAGCTCTTAAAC-30 Morgens et al.,62 N/A

    Recombinant:

    Article Title: GCN2 is a determinant of the response to WEE1 kinase inhibition in small-cell lung cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Wee1 (D10D2) mAb Rabbit Cell Signaling Technology CAT# 13084T; RRID: AB_2713924 Anti-GCN2 (phospho T899) antibody Abcam CAT# ab75836; RRID: AB_1310260 GCN2 antibody Abcam CAT# ab157775; RRID: Phospho-S6 Ribosomal Protein (Ser235/236) (D57.2.2E) XP Rabbit Cell Signaling Technology CAT# 2211S; RRID: AB_331679 HSP90 Rabbit mAb Cell Signaling Technology CAT# 4877S; RRID: AB_2233307 ATF-4 (D4B8) Rabbit mAb Cell Signaling Technology CAT# 11815S; RRID: AB_2616025 Phospho-eIF2a (Ser51) (D9G8) XP Rabbit mAb Cell Signaling Technology CAT# 3398; RRID: AB_2096481 eIF2a (D7D3) XP Rabbit mAb Cell Signaling Technology CAT# 5324; RRID: AB_10692650 CDK1 Cell Signaling Technology CAT# 28439S; RRID: AB_2798959 phospho-CDK1 Cell Signaling Technology CAT# 9111S; RRID: AB_331460 Bacterial and virus strains EnduraTM Chemically Competent Cells Lucigen Cat# 60240-1 Chemicals, peptides, and recombinant proteins Polyethylenimine (PEI) Polysciences Cat# 23966-1 Polybrene Millipore-Sigma Cat# TR-1003-G Opti-MEM Thermo Fisher Scientific Cat# 31985088 RPMI 1640 Corning Cat# 15-040-CV DMEM Thermo Fisher Scientific Cat# 11965092 Bovine Growth Serum Thermo Fisher Scientific Cat# SH3054103HI Penicillin-Streptomycin-Glutamine Thermo Fisher Scientific Cat# 10378016 Fetal Bovine Serum Thermo Fisher Scientific Cat#16000044 Matrigel BD biosciences Cat# 356237 Tris(2-carboxyethyl) phosphine hydrochloride (TCEP) Thermo Fisher Scientific Cat# 77720 PBS antibody stabilizer Thermo Fisher Scientific Cat# NC0414486 Paraformaldehyde (PFA) Thermo Fisher Scientific Cat# 28906 Saponin Millipore-Sigma Cat# S7900-100G Bovine Serum Albumin (BSA) Millipore-Sigma Cat# A3059 Sodium azide Millipore-Sigma Cat# 71289 Cell-ID Intercalator-Ir Fluidigm Cat# 201192B L15 media Millipore-Sigma Cat# L1518 Collagenase I Millipore-Sigma Cat# C0130 Collagenase II Millipore-Sigma Cat# 6885 Collagenase IV Millipore-Sigma Cat# 5138 Elastase CellSystems Cat# LS002292 DNAseI Millipore-Sigma Cat# 10104159 RBC Lysis Buffer Thermo Fisher Scientific Cat# 00-4333-57 AZD-1775 SYNthesis Cat# WZQ-0447-032 Raphin1 Tocris Cat# 1A/242832 Histogel Thermo Fisher Scientific Cat# NC9150318 Triton X-100 Millipore-Sigma Cat# T8787-100ML (Continued on next page) Cell Reports 43, 114606, August 27, 2024 11 .. REAGENT or RESOURCE SOURCE IDENTIFIER PD 407824 (Wee1 and Chk1 inhibitor) Tocris Cat# 2694 DMSO Sigma-Aldrich Cat# D8418-500mL RIPA buffer Cell Signaling Technology Cat# 9806 Benzonase Merck-Millipore Cat# 71206-3 Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23227 Protein Assay Dye Reagent Bio-Rad Cat# 5000006 Streptavidin beads Thermo Fisher Scientific Cat# 20357 MgCl2 Sigma Cat# M8266 ActivXTM Desthiobiotin-ATP Probe Thermo Fisher Scientific Cat# 88311 2x Laemmli sample buffer Bio-Rad Cat# 1610737 PEG Sigma Cat# p5413 QIAamp DNA Blood Maxi Kit Qiagen Cat# 51194 BstXI NEB Cat# R0113S BlpI NEB Cat# R0585S QIAquick Gel Extraction Kit Qiagen Cat# 28704 T4 ligation buffer NEB Cat# B0202S SOC media Sigma Cat# S1797 Critical commercial assays Herculase II Fusion DNA Polymerase kit Agilent Cat# 600675 Deposited data RNA-seq data GEO GSE246354 Raw data Mendeley Data https://doi.org/10.17632/f5jtt3s8hv.1 Experimental models: cell lines 293T ATCC HTB-3216TM NCI-H82 ATCC HTB-175TM NJH29 Sage Lab N/A NCI-H69 ATCC HTB-119TM NCI-H2081 ATCC CRL-5920TM Experimental models: organisms/strains NOD-scid IL2Rgammanull mice (NSG mice) The Jackson Laboratory #005557 Oligonucleotides Genome-Wide CRISPR-KO library Morgens et al.,62 N/A oMCB1562: 50-AGGCTTGGATTTCTATAAC TTCGTATAGCATACATTATAC-30 Morgens et al.,62 N/A oMCB1563: 50-ACATGCATGGCGGTAAT ACGGTTATC-30 Morgens et al.,62 N/A oMCB1439: 50-CAAGCAGAAGACGGCAT ACGAGATGCACAAAAGGAAACTCACCCT-30 Morgens et al.,62 N/A R: 50-AATGATACGGCGACCACCGAGATC TACACGATCGGAAGAGCACACGTCTGAA CTCCAGTCACNNNNNNCGACTCGGTGC CACTTTTTC-30 Morgens et al.,62 N/A Sequencing primer: 50-GCCACTTTTTCAAG TTGATAACGGACTAGCCTTATTTAAACTTG CTATGCTGTTTCCAGCTTAGCTCTTAAAC-30 Morgens et al.,62 N/A



    Similar Products

    fluidigm sciences 201192b  (fluidigm)
    96
    fluidigm fluidigm sciences 201192b
    Fluidigm Sciences 201192b, supplied by fluidigm, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+id+intercalator+ir+fluidigm/Cell-ID+Intercalator-Ir/pmc13044534-113-13-13
    Average 96 stars, based on 1 article reviews
    fluidigm sciences 201192b - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    fluidigm 201192b  (fluidigm)
    96
    fluidigm fluidigm 201192b
    Fluidigm 201192b, supplied by fluidigm, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+id+intercalator+ir+fluidigm/Cell-ID+Intercalator-Ir/pm41895259-261-8-8
    Average 96 stars, based on 1 article reviews
    fluidigm 201192b - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    iridium 201192b fluidigm 6  (fluidigm)
    96
    fluidigm iridium 201192b fluidigm 6
    Iridium 201192b Fluidigm 6, supplied by fluidigm, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+id+intercalator+ir+fluidigm/Cell-ID+Intercalator-Ir/pm41742894-277-0-2
    Average 96 stars, based on 1 article reviews
    iridium 201192b fluidigm 6 - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    201192a cell id cisplatin fluidigm  (fluidigm)
    96
    fluidigm 201192a cell id cisplatin fluidigm
    201192a Cell Id Cisplatin Fluidigm, supplied by fluidigm, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+id+intercalator+ir+fluidigm/Cell-ID+Intercalator-Ir/pm41529694-273-271-274
    Average 96 stars, based on 1 article reviews
    201192a cell id cisplatin fluidigm - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    3148008b cell id intercalator ir fluidigm  (fluidigm)
    94
    fluidigm 3148008b cell id intercalator ir fluidigm
    3148008b Cell Id Intercalator Ir Fluidigm, supplied by fluidigm, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+id+intercalator+ir+fluidigm/Anti-Human+IL-17A+(BL168)-148Nd/pm41529694-273-265-269
    Average 94 stars, based on 1 article reviews
    3148008b cell id intercalator ir fluidigm - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    193ir fluidigm 201192b  (fluidigm)
    96
    fluidigm 193ir fluidigm 201192b
    193ir Fluidigm 201192b, supplied by fluidigm, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+id+intercalator+ir+fluidigm/Cell-ID+Intercalator-Ir/pmc12572286__41416_2025_3137_MOESM1_ESM-8-263-265
    Average 96 stars, based on 1 article reviews
    193ir fluidigm 201192b - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    eh12 2 h7 3175008b fluidigm anti human tigit 209bi mbsa43 3209013b fluidigm iridium 201192a fluidigm  (fluidigm)
    96
    fluidigm eh12 2 h7 3175008b fluidigm anti human tigit 209bi mbsa43 3209013b fluidigm iridium 201192a fluidigm
    Eh12 2 H7 3175008b Fluidigm Anti Human Tigit 209bi Mbsa43 3209013b Fluidigm Iridium 201192a Fluidigm, supplied by fluidigm, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+id+intercalator+ir+fluidigm/Cell-ID+Intercalator-Ir/pmc12368159__41698_2025_1091_MOESM1_ESM-3-331-333
    Average 96 stars, based on 1 article reviews
    eh12 2 h7 3175008b fluidigm anti human tigit 209bi mbsa43 3209013b fluidigm iridium 201192a fluidigm - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    00 5523 00 ir intercalator fluidigm 201192a kapa hyper libraries  (fluidigm)
    96
    fluidigm 00 5523 00 ir intercalator fluidigm 201192a kapa hyper libraries
    00 5523 00 Ir Intercalator Fluidigm 201192a Kapa Hyper Libraries, supplied by fluidigm, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+id+intercalator+ir+fluidigm/Cell-ID+Intercalator-Ir/pm40834854-734-164-166
    Average 96 stars, based on 1 article reviews
    00 5523 00 ir intercalator fluidigm 201192a kapa hyper libraries - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    nil fluidigm cell id intercalator ir  (fluidigm)
    96
    fluidigm nil fluidigm cell id intercalator ir
    Nil Fluidigm Cell Id Intercalator Ir, supplied by fluidigm, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+id+intercalator+ir+fluidigm/Cell-ID+Intercalator-Ir/pmc12318238__pnas%2E2506673122%2Esapp-171-341-342
    Average 96 stars, based on 1 article reviews
    nil fluidigm cell id intercalator ir - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier

    Image Search Results